CramX Logo
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Document preview page 1

Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 1

Document preview content for Test Bank For Genetics: A Conceptual Approach, 6th Edition

Test Bank For Genetics: A Conceptual Approach, 6th Edition

Take your exam prep to the next level with Test Bank For Genetics: A Conceptual Approach, 6th Edition—get instant access to essential questions.

Michael Davis
Contributor
4.5
72
over 1 year ago
Preview (31 of 561 Pages)
100%
Log in to unlock
Page 1 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 1 preview imagePage 11. Which of the following statements CORRECTLY describes the facts about introns andexons?A)The number of introns is always less than the number of exons in a gene.B)Introns are degraded in the cytoplasm.C)All eukaryotic genes contain an intron.D)Mitochondrial and chloroplast genes do not contain introns.E)Introns do not contain sequence-specific information.2. In 1958, Francis Crick proposed that genes and their corresponding polypeptides are“colinear.” Which of the following statements concerning the concept of colinearity isINCORRECT?A)Colinearity means that the linear nucleotide sequence of a given gene correspondsdirectly to the linear amino acid sequence in the corresponding polypeptide.B)The number of nucleotides in a gene should be precisely proportional to thenumber of amino acids present in the corresponding polypeptide.C)Colinearity generally holds true for the coding regions of prokaryotic viral genes.D)The vast majority of eukaryotic genes follow the concept of colinearity.E)The exception to colinearity between genes and polypeptides is the presence ofuntranslated sequences (UTRs).3. How many introns are present on a gene that consists of four exons?A)twoB)threeC)fourD)fiveE)The number cannot be determined from the information provided.4. Which of the following statements regarding gene structure is TRUE?A)The amino acid sequence of a polypeptide can be precisely predicted by thenucleotide sequence of the gene that encodes it.B)The number of introns found in organisms is species specific.C)The number of exons and introns generally correlates to the complexity of theorganisms.D)Intron cleavage and exon splicing are both mediated exclusively by proteinenzymes.E)The number of exons is always less than the number of introns in a gene.
Page 2 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 2 preview image
Page 3 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 3 preview imagePage 25. Which of the following statements about bacterial mRNA transcripts is TRUE?A)Unlike eukaryotes, bacterial mRNA transcripts do not typically containuntranslated regions.B)The Shine–Dalgarno sequence associates with an RNA component in the smallsubunit of ribosomes.C)Transcription and translation take place sequentially in bacterial cells.D)Most of bacterial genes contain a large number of introns and small number ofexons.E)The 5end and 3end of mRNA transcripts are modified in bacteria.6. Which of the following statements about ribosomes and ribosomal RNA is NOT true?A)Ribosomes typically contain about 80% of the total cellular RNA.B)Ribosomal RNA is processed in both prokaryotes and eukaryotes.C)In eukaryotes, genes for rRNA are usually present within tandem repeats.D)Each ribosomal RNA component is encoded by a separate gene.E)In eukaryotes, the rRNA transcripts are processed further by snoRNAs within thenucleus.7. The spliceosome is a large, ribonucleoprotein complex located in the:A)cytoplasm.B)endoplasmic reticulum.C)Golgi aparatus.D)nucleus.E)nucleolus.8. The 5and 3untranslated regions (UTRs) of processed mRNA molecules are derivedfrom:A)exons.B)introns.C)promoters.D)terminators.E)the protein-coding region.
Page 4 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 4 preview imagePage 39. Which of the following statements about group I and group II introns is NOT true?A)Both group I and II introns form elaborate and characteristic secondary structureswith loops.B)The splicing mechanism of group II introns is similar to that ofspliceosome-mediated nuclear pre-mRNA splicing.C)The length of group I and group II introns is much longer than the exons within thestructures.D)Group I and group II introns are exclusively found in mitochondrial and chloroplastencoded genes.E)Both group I and group II introns are both found in bacterial genes.10. Which of the following statements BEST explains why only pre-mRNA receives a 5cap?A)The enzyme that initiates the capping step is known to associate with RNApolymerase II, which generates pre-mRNAs.B)Only pre-mRNAs contain proper sequences for the cap to be added on.C)The tail of the pre-mRNA can recruit the right combination of enzymes forcapping.D)Nuclear pore complexes only recognize pre-mRNAs and allow them out to thecytoplasm for the capping process to begin.E)rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in thecytoplasm.11. Which of the following phenomena is NOT affected by the presence of alternativesplicing?A)speciationB)developmentC)organismal complexityD)tissue specificityE)RNA interference12. Which of the following spliceosomal components specifically recognizes and binds tothe branch point of the intron during pre-mRNA splicing?A)U1B)U2C)U5D)U6E)spliceosomal proteins
Page 5 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 5 preview imagePage 413. The human gene encoding calcitonin contains six exons and five introns and is locatedon chromosome 11. The pre-mRNA transcript from this gene can generate eithercalcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner.Calcitonin produced from the thyroid gland is 32 amino acids long and functions toregulate the calcium while CGRP, which contains 37 amino acids, is produced by thebrain cells and involved in transmission of pain. Which of the following processesmakes production of two functionally and structurally different proteins from the samegene possible?A)self-spicing intronsB)differential transcriptionC)alternative replicationD)5capping and polyadenylationE)alternative RNA processing14. Guide RNAs are needed in:A)transcription.B)translation.C)RNA interference.D)RNA editing.E)RNA splicing.15. Which mechanism allows for more than one polypeptide to be encoded by a singlegene?A)regulated transcriptionB)RNA interferenceC)alternative RNA processingD)self-splicing of intronsE)RNA methylation16. Which of the following elements would NOT be found in an mRNA molecule?A)protein-coding regionB)3untranslated regionC)5untranslated regionD)promoterE)start and stop codons
Page 6 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 6 preview imagePage 517. Which of the following is found in the primary product of transcription but not in amature mRNA molecule?A)start codonB)promoterC)exonsD)intronsE)stop codon18. The information needed during RNA editing comes MOST directly from:A)pre-mRNA.B)mRNA.C)rRNA.D)tRNA.E)guide RNA.19. Scientists once believed that each gene can encode a single polypeptide. We now knowthat _____ and _____ allow a single gene to encode more than one polypeptide.A)transcription; translationB)polyadenylation; RNA transportC)DNA methylation; chromatin condensationD)alternative processing; RNA editingE)gene silencing; RNA interference20. Which mechanism allows for the production of polypeptides that are not entirelyencoded by DNA?A)regulated transcriptionB)RNA interferenceC)alternative RNA processingD)RNA editingE)colinearity
Page 7 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 7 preview imagePage 621. Below is a list of steps of intron removal and splicing during pre-mRNA processing.Please select the choice that lists the steps in the CORRECT sequential order.1. Attachment of snRNP U1 to the 5splice site2. Transcription of the DNA template into the pre-mRNA molecule3. Release of lariat structure4. Splicing together of exons5. Transesterification reaction at the branch point adenineA)1, 2, 3, 4, 5B)4, 1, 3, 5, 2C)2, 1, 5, 3, 4D)3, 5, 1, 2, 4E)5, 3, 4, 1, 222. Below is a list of steps of eukaryotic pre-mRNA processing. Please select the choicethat lists the steps in the CORRECT sequential order.1. Recognition and binding the 3AAUAAA sequence by specific protein factors2. Cleavage at the poly(A) site3. Addition of the 5cap4. Export to the cytoplasm5. Addition of the poly(A) tailA)3, 1, 2, 5, 4B)2, 3, 4, 5, 1C)4, 2, 3, 1, 5D)1, 3, 5, 4, 1E)5, 4, 1, 3, 223. The 5cap on an mRNA is important for all the processes listed below except for the_____ of an mRNA molecule.A)transcriptionB)intron removalC)stabilityD)initiation of translationE)ribosomal interaction
Page 8 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 8 preview imagePage 724. A key modification in the 3end of eukaryotic mRNA is the addition of 50 to 250adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a functionof the poly(A) tail?A)The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail.B)The poly(A) tail facilitates the attachment of the ribosome to the mRNA.C)The poly(A) tail is important for proper nuclear export of the mRNA.D)The poly(A) tail at the 3end translates to a long stretch of repeated amino acids.E)Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.25. During the posttranscriptional processing of pre-mRNA, a 5cap is added to anmRNA. Arrange the following steps of the capping process in the CORRECT order.1. Addition of a guanine nucleotide via a 5-5bond2. Removal of a phosphate from a ribonucleotide triphosphate at the 5head of thepre-mRNA3. Methylation at the 2position of the sugar in the second and the third nucleotides4. Methylation at position 7 of the terminal guanine baseA)1, 2, 3, 4B)2, 4, 1, 3C)4, 1, 3, 2D)2, 1, 4, 3E)3, 2, 4, 126. During the posttranscriptional processing of pre-mRNA, a 5cap is added to an mRNAin step-by-step manner. Which of the following reasons prevents the 5cappingprocess, involving methylation, from occurring on a DNA strand?A)lack of an OH group on the 2carbon of the deoxyriboseB)lack of an OH group on the 3carbon of the deoxyriboseC)lack of a uracil nitrogenous base on the DNA strandD)lack of GTP hydrolysis associated with DNA transcriptionE)lack of a H on the 4carbon of the deoxyribose27. Which of the following consensus sequences are NOT found in nuclear introns?A)GU at the 5splice site at the beginning of the intronB)AG at the 3splice site at the end of the intronC)CCA at the 3site downstream of the branch pointD)a at the lariat branch point siteE)3CAGG consensus sequence at the 3splice site
Page 9 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 9 preview imagePage 828. What do group I and group II introns have in common?A)Both are found in mitochondrial genes.B)Both are found in bacteriophages.C)Both are known to be self-splicing introns.D)Both are found in protein-coding genes of chloroplasts.E)Both are frequently found in eukaryotic genes.29. Which of the following statements CORRECTLY describes the concept of alternativesplicing?A)Eukaryotic gene and protein sequences are precisely colinear.B)With the rare exception of RNA editing, every nucleotide contained in a processedmRNA molecule is derived from exon sequences.C)Every other intron is removed in an alternate manner to generate a functionalmRNA transcript.D)Only a subset of the same mRNA transcripts is specifically selected for splicing inthe nucleus.E)Multiple protein products are often produced from single eukaryotic genes.30.Given the figure below, within which of the following would the 5ʹ untranslated regionbe located?A)promoterB)exon 1C)exon 4D)intron 1E)A 5ʹ untranslated region would not be present in this figure.
Page 10 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 10 preview imagePage 931. Given the figure below, within which of the following would the Shine–Dalgarnosequence be located?A)promoterB)exon 1C)exon 4D)intron 1E)A 5ʹ untranslated region would not be present in this figure.32. Which of the following intron types requires spliceosomes for removal?A)group I intronB)group II intronC)group III intronD)nuclear pre-mRNAE)tRNA33. Which of the following intron types is present only in eukaryotes?A)nuclear pre-mRNAB)group I intronC)group II intronD)tRNAE)group III intron34. Thecalcitoningene can encode either the hormone calcitonin or a protein calledcalcitonin-gene-related peptide depending on which 3cleavage site is used. In thethyroid gland, cleavage and polyadenylation occur after the fourth exon leading tocalcitonin production. However, in the brain, the exact same transcript is cleaved afterthe sixth exon yielding calcitonin-gene-related peptide. This is an example of:A)multiple capping.B)alternative RNA processing.C)polyadenylation.D)environmental influence.E)mutation.
Page 11 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 11 preview imagePage 1035. Which of the following processes does NOT support the observation that the amino acidsequence of a protein may not be the same as that encoded by its gene?A)RNA editingB)alternative splicingC)multiple 3cleavage sitesD)5cappingE)errors that occurred during transcription36. The sequence below represents a pre-mRNA. Which of the following represents thesequence of the spliced mRNA that would result from this pre-mRNA sequence?mRNA: 5ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3A)5ACUGGACAGUCGGCACCACG 3B)5GUAAGAAUACAAC 3C)5UGACCUGUCAGCCGUGGUGC 3D)5ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3E)5AGAAUACAACACAGUCGGCACCACG 337.The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹsplice site were mutated to a C?mRNA: 5ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3A)The U2 snRNA would not be able to bind to the branch point because it could notrecognize it.B)The spliceosome complex would be degraded because it could no longer recognizethe 5ʹ splice site.C)The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.D)Splicing would still occur appropriately because the G is not essential at the 5ʹsplice site.E)The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to befunctional.38.The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the followingcould be a plausible mechanism by which a 5ʹ cap could enhance initiation?A)The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly.B)The 5ʹ cap could recruit proteins that would help to assemble the ribosomes.C)The 5ʹ cap could assist in the identification of stop codons within the mRNA.D)The 5ʹ cap could serve as a marker for the ribosome to locate promoters.E)The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access tothe DNA.
Page 12 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 12 preview imagePage 1139. What would be the MOST likely effect of mutating the consensus sequence found at the5' splice site of an intron?A)A shorter than normal protein would be produced.B)Replication would be inhibited.C)A longer than normal mRNA would be produced.D)A longer than normal DNA would be produced.E)Transcription would terminate prematurely.40. If a splice site were mutated so that splicing did not take place, what would be the effecton the amino acid sequence?A)It would be shorter than normal.B)It would be longer than normal.C)It would be the same length but would encode a different protein.D)It would be unable to fold into its correct structure.E)It depends on the mutant mRNA sequence.41. When studying a plant's protein production, a scientist found two different proteins. Thefirst one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second oneonly contained amino acids from exons from 1, 2, and 3. Which of the following isMOST likely responsible for this difference?A)a mutation in the gene that encodes an miRNAB)posttranslational modificationC)RNA editingD)alternative RNA processingE)a mutation in the gene that encodes a snoRNA42. Suppose an organism ingests a drug that disassembles its spliceosomes, rendering themnonfunctional. Which of the following would be seen MOST immediately in thisorganism?A)All translation would stop.B)tRNA bases would no longer be modified into rare bases.C)Introns would not be removed from the pre-mRNA.D)mRNA would not be able to bind the 5ʹ cap.E)rRNA would no longer be appropriately processed.
Page 13 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 13 preview imagePage 1243. Cystic fibrosis is caused by a mutation in theCFTRgene. The normalCFTRgenecomprises approximately 190,000 nucleotides and produces an mRNA of 6128nucleotides in length. What is a possible explanation for the difference in the sizes of thegene and the mRNA?A)The promoter of theCFTRgene is likely silenced by miRNAs prior to mRNAproduction.B)TheCFTRgene likely has many introns that are excised prior to translation of theCFTRprotein.C)The 5ʹ cap and the poly(A) tail get removed prior to translation of theCFTRprotein.D)Methylation of the 5ʹ cap silences portions of the gene, preventing those regionsfrom being transcribed into mRNA.E)The mutation that causes cystic fibrosis creates a new terminator sequence,resulting in a shorter mRNA.44.Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹcap. What would be an expected result?A)Transcription would continue past the end of the gene coding sequence resulting ina longer pre-mRNA transcript.B)Translation would continue past the end of the gene coding sequence resulting in alonger pre-mRNA transcript.C)Transcription would not occur as the transcription factors would not be able to bindto the promoter.D)Translation would not occur as the ribosome would not be able to bind to themRNA.E)Replication would not occur as DNA polymerase would not be able to bind to theDNA at the origin of replication.45. In your own words, list a comprehensive definition for “gene” at the molecular level.46. What is an snRNP and what role does it play in the cell?47. What is a pulse–chase experiment? Explain how this technique can be used to follow theproducts of a short-term event.48. Devise and describe a strategy to conduct a pulse–chase experiment to determine ifnewly transcribed eukaryotic RNA actually moves from the nucleus to the cytoplasm.
Page 14 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 14 preview imagePage 1349. Describe the evidence that suggested that RNA was the carrier of genetic informationfrom the nucleus to the ribosome.50. What are guide RNAs (gRNAs) and what do they do?51. For a time, a gene was defined as a sequence of DNA that encodes a polypeptide.Critique this outdated notion of what a gene is and propose a more comprehensivedefinition.52. Use the pre-mRNA sequence shown below to answer the following questions.mRNA: 5ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3a.Underline the 5and 3splice sites, then write the sequence of the spliced mRNAin the space provided.b.Predict what would happen if the G in the 5splice site were mutated to a C.c.We learned in this chapter that the 5cap in an mRNA plays a role in translationinitiation. What do you think is one plausible mechanism by which a 5cap can enhanceinitiation? How can you experimentally demonstrate that a 5cap is important for thisprocess?53. Explain how RNA editing violates a general principle of molecular genetics.54. Devise a strategy to prove that splicing occurs in the nucleus.55. Critique the idea that the information needed to encode a particular polypeptide alwaysresides within a single gene.56. Which of the following nitrogenous bases is frequently modified enzymatically tobecome a rare type of nitrogenous base in tRNA?A)adenineB)uracilC)thymineD)cytosineE)guanine
Page 15 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 15 preview imagePage 1457. Anticodons are found in _____ molecules.A)mRNAB)tRNAC)rRNAD)snRNAE)miRNA58. Which of the following observations supports the notion that the gene is simply a set ofDNA sequences that are transcribed into a single RNA molecule that encodes a singlepolypeptide?A)Alternative splicing—a single gene can yield multiple mRNA and protein products.B)A single ribosomal RNA transcript can liberate several RNA molecules via furtherprocessing.C)RNAs can be the functional product of a gene without being translated into aprotein product.D)Within a protein coding region, each codon represents a specific amino acid thatwill be linked to form a polypeptide.E)Regulatory elements are part of a gene that regulate timing, degree, and specificityof gene expression but are not transcribed.59. To which part on a tRNA would an amino acid attach during tRNA charging?A)3acceptor armB)anticodon armC)TC armD)DHU armE)extra arm60. Draw the tRNA cloverleaf secondary structure, labeling the various loops and stems.Indicate the functions of the acceptor stem and the anticodon. How are modified basesproduced in tRNAs?61. Compare and contrast the mechanisms of splicing for nuclear pre-mRNA introns, groupI introns, group II introns, and tRNA introns.
Page 16 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 16 preview imagePage 1562. Which of the following rRNA components originates from a separate gene transcriptrather than as a cleaved product of a long single precursor rRNA transcript?A)prokaryotic 16S rRNAB)prokaryotic 23S rRNAC)eukaryotic 18S rRNAD)eukaryotic 5.8S rRNAE)eukaryotic 5S rRNA63. Below is a list of steps in the processing of ribosomal RNAs. Please select the choicethat lists the steps in the CORRECT sequential order.1. Methyl groups added to specific bases and the 2-carbon atom of some ribose sugars2. Transcription of the rRNA precursors from DNA3. Cleavage of precursor rRNA4. Individual rRNA molecules ready for ribosome assembly5. Trimming of precursor rRNAA)3, 1, 2, 5, 4B)2, 3, 4, 5, 1C)4, 2, 3, 1, 5D)1, 3, 5, 4, 1E)2, 1, 3, 5, 464. A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process?A)RNA splicing of pre-mRNAB)translationC)assembly of the nucleosomeD)replicationE)transcription65. Which class of RNA is MOST abundant in cells?A)mRNAB)tRNAC)rRNAD)snRNAE)miRNA
Page 17 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 17 preview imagePage 1666. Which of the following classes of RNAs is unique to eukaryotes?A)messenger RNA (mRNA)B)ribosomal RNA (rRNA)C)transfer RNA (tRNA)D)small nuclear RNAs (snRNAs)E)CRISPR RNAs (crRNAs)67. siRNAs and miRNAs function in which of the following processes?A)transcriptionB)translationC)RNA interferenceD)RNA editingE)RNA splicing68. What is the similarity between miRNAs, siRNAs, and piRNAs?A)All three types originate from transposons or viruses and are found in allorganisms.B)They all target and degrade the gene from which they were transcribed.C)All three are generated from a single-stranded RNA that gets cleaved.D)All three can influence chromatin structure, which, in turn, can influence geneexpression.E)All three associate with Piwi proteins in order to mediate RNA degradation.69. A scientist is studying a gene known as theXYZgene in eukaryotes. Into a eukaryoticcell, she inserts an miRNA that is complementary to a portion of theXYZmRNA foundin the cell.What result would you predict?A)There will be an increase in the amount ofXYZprotein made.B)There will be a decrease in the amount ofXYZprotein made.C)There will be an increase in the transcription of theXYZgene.D)There will be a decrease in the transcription of theXYZgene.E)No change will result from the insertion of the miRNA.70. A scientist is studying a gene known as theABCgene in bacteria. Into a bacterial cell,she inserts an miRNA that is complementary to a portion of theABCmRNA found inthe cell. What result would you predict?A)There will be an increase in the amount ofABCprotein made.B)There will be a decrease in the amount ofABCprotein made.C)There will be an increase in the transcription of theABCgene.D)There will be a decrease in the transcription of theABCgene.E)No change will result from the insertion of the miRNA.
Page 18 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 18 preview imagePage 1771. A microbiologist isolated a mutant strain ofE. colithat is extremely susceptible tobacteriophage infection, by a wide range of bacteriophages. Which of the followinggenes might she explore as a possible site of the mutation that results in this phenotype?A)A gene that encodes a small nucleolar RNAB)A gene that encodes a Cas proteinC)A gene that encodes a Piwi-interacting RNAD)A gene that encodes either a miRNA or a siRNAE)A gene that encodes an immune RNA72. What attributes make miRNA a potent agent for silencing gene expression by allowingit to silence a large number of genes simultaneously?73. Discuss the features ofC. elegansthat make it an important model system for studies ofanimal genetics and development. Include in your answer some unique features ofC.eleganscompared to other model systems.74. Which of the following small RNA types is unique to prokaryotes?A)siRNAB)crRNAC)miRNAD)piRNAE)lncRNA75. Which of the following regulatory RNA types is different from the rest in terms of itslength?A)siRNAB)crRNAC)miRNAD)piRNAE)lncRNA
Page 19 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 19 preview imagePage 18Answer Key1. A2. D3. B4. C5. B6. D7. D8. A9. D10. A11. E12. B13. E14. D15. C16. D17. D18. E19. D20. D21. C22. A23. A24. D25. D26. A27. C28. C29. E30. B31. E32. D33. A34. B35. D36. A37. C38. B39. C40. E41. D42. C43. B44. D
Page 20 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 20 preview imagePage 1945.46.47.48.49.50.51.52.53.54.55.56. B57. B58. D59. A60.61.62. E63. E64. B65. C66. D67. C68. D69. B70. E71. B72.73.74. B75. E
Page 21 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 21 preview imagePage 11. In the introduction to this chapter, the use of the CRISPR-Cas9 system to make adeletion of exon 23 containing a premature stop codon inmdxmice was described. Theresulting mice had partially restored dystrophin protein and muscle function. Which ofthe following CRISRP-Cas9 mediated changes might lead to a better restoration ofdystrophin protein and muscle function?A)A deletion of exon 24 in addition to exon 23B)A deletion of intron 23C)A deletion of 30 bases within exon 23D)A deletion of 25 bases within exon 21E)An insertion of a corrected copy of exon 23 after the mutant exon 232. Which of the following statements does NOT describe a challenge of working at themolecular level?A)Cells contain thousands of genes.B)Individual genes cannot be seen.C)It is not possible to isolate DNA in a stable form.D)A genome can consist of billions of base pairs.E)No physical features mark the beginning or end of a gene.3. Which of the following is a set of molecular techniques for locating, isolating, altering,and studying DNA segments?A)in situ hybridizationB)gel electrophoresisC)molecular cloningD)Southern blottingE)recombinant DNA technology4. Gel electrophoresis can be used to separate DNA on the basis of:A)size.B)electrical charge.C)nucleotide content.D)the probe used.E)both size and electrical charge.5. Which of the following statements is NOT correct regarding type II restrictionenzymes?A)They can create blunt ends.B)They make double-stranded cuts in DNA.C)They recognize specific sequences and make cuts further away from therecognition sequence.D)They are named based on their bacterial origin.
Page 22 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 22 preview imagePage 26. Which of the following statements CORRECTLY describes DNA ligase?A)DNA ligase forms hydrogen bonds between nucleotide bases.B)DNA ligase can seal nicks between amino acids.C)DNA ligase recognizes and cuts at specific sequences.D)DNA ligase is necessary for creating recombinant plasmids.E)DNA ligase is a requirement of a sequencing reaction.7. Southern blotting is a technique used to transfer _____ to a solid Moderate.A)DNAB)RNAC)proteinD)DNA and RNAE)DNA, RNA, or protein8. Antibodies are to Western blots as _____ is/are to Southern blots.A)RNA probesB)proteinsC)DNA probesD)amino acidsE)DNA or RNA probes9. Which of the following would be MOST appropriate for cloning a gene that is 300 kb insize?A)plasmidB)cosmidC)phage lambdaD)BACE)yeast phage10. A gene does not contain the necessary restriction enzyme sites for cloning into aplasmid vector. What is a possible option?A)Increase the amount of gene used.B)Add linkers to generate new restriction enzyme sites.C)Use a cosmid as a cloning vector.D)Use dideoxy sequencing to obtain the sequence of the gene.E)Cut the DNA with a blunt end cutter.
Page 23 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 23 preview imagePage 311. All of the following are requirements of a bacterial cloning vector EXCEPT:A)origin of replication.B)unique restriction enzyme sites.C)Ti plasmid.D)selectable markers.12. During gel electrophoresis, large DNA fragments will _____ small DNA fragments.A)migrate more rapidly thanB)migrate at the same speed asC)migrate more slowly thanD)cause degradation ofE)separate into13. You are interested in a particular segment of rhinoceros DNA and would like to clone itinto a cloning plasmid. You have the following restriction map of the region thatincludes the DNA of interest and the plasmid (E =EcoRI, H =HindIII, X =XbaI, S =SphI, N =NotI).Which restriction enzymes would you choose to clone the DNA of interest into thecloning vector?A)E and HB)SC)X and ND)S and N
Page 24 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 24 preview imagePage 414.The recognition site forBamHI is 5'GGATCC3'3'CCTAGG3'. Which of the followingrestriction sites when digested would create a cohesive end that could be ligated to aBamHI digested DNA fragment?A)EcoRII 5'C CAGG3'3'GGTCC5'B)PvuII5'CA GC TG3'3'GT CG AC5'C)EcoRI5'GAATTC3'3'CTTAAG5'D)BglII5'AG ATCT3'3'TCTA GA5'E)CofI5'GCGC3'3'CGCG5'15. Which of the following traits of type I restriction enzymes make them unsuitable forrecombinant DNA technology? (Select all that apply.)A)They are large, multi-subunit enzymes.B)They make double-stranded cuts in DNA.C)They cleave and methylate DNA.D)They cleave at sequences far from their recognition site.E)They were discovered in bacteria.16. A scientist attempts to use the CRISPR-Cas9 system to edit a single gene within a cell.She finds that, in addition to editing the desired gene, she has edited several other genesas well. What are reasonable options for her to try next in order to target just the gene ofinterest? (Select all that apply.)A)Add less Cas9 enzyme.B)Create a longer sgRNA.C)Try a different sgRNA that will still pair within the gene of interest.D)Use separate crRNA and tracrRNA molecules.E)Use a higher-fidelity version of Cas9.
Page 25 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 25 preview imagePage 517. A scientist is studying a normal tissue sample and a cancerous tissue sample. Whatmethod might she use to determine whether the transcription of gene X is upregulated inthe cancerous tissue sample?A)Carrying out a Southern blot using the cancerous tissue sample onlyB)Carrying out a Southern blot using both samplesC)Carrying out a Northern blot using the cancerous tissue sample onlyD)Carrying out a Northern blot using both samplesE)Carrying out a Western blot using the cancerous tissue sample only18. A scientist edits a mammalian genome by inserting a GFP reporter sequencedownstream of a gene of interest. Which of the following methods is she likely to haveused to make this change?A)site-directed mutagenesisB)oligonucleotide-directed mutagenesisC)CRISPR-Cas9 genome editing followed by nonhomologous end joining (NHEJ)D)CRISPR-Cas9 genome editing followed by homologous recombination (HR) witha donor templateE)mutagenesis with radiation19. The haploid human genome contains about 3 × 109nucleotides. On average, howmany DNA fragments would be produced if this DNA was digested with restrictionenzymePstI (a 6-base cutter)?RsaI (a 4-base cutter)? How often would an 8-base cuttercleave?20. What are Northern analyses used for? Describe the steps involved in performing aNorthern analysis, and describe how levels of gene expression are determined.
Page 26 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 26 preview imagePage 621. You are attempting to determine whether a plant-derived processed food sample (forexample, a corn chip) contains material from a genetically modified organism(GMO). First, you crush the sample and attempt to extract DNA from it. Next, youperform PCR using two different sets of primers. One primer set will amplify a DNAsequence present in all plants. The second primer set will amplify a DNA sequenceonlyfound in GMO plants.a.Why must you use both sets of primers for this experiment?b.In addition to the test sample, you obtain a negative control sample (foodmaterial you are certaindoes notcontain GMO material) and a positive control sample(food material you are certaindoescontain GMO material). You perform the DNAextraction on these three samples and then the PCR reactions with each of the twoprimer sets described above. Complete the following table with your expectations forthis PCR reaction.c.You obtain the results shown in the panel below. What conclusions can you drawfrom these reaction results? Does this test sample contain genetically modifiedcomponents? Why or why not?
Page 27 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 27 preview imagePage 7Use the following to answer questions 22-23:Figure Abelow shows a restriction map of a rare prokaryotic gene with its direction oftranscription indicated by the arrow.Figure Bshows the unique restriction sites contained withina plasmid-cloning vector. The blackened region in Figure A represents the amino acid codingsequence of a protein that can be used in humans as a vaccine. The striped region in Figure B is ahighly active, constitutive (unregulated) prokaryotic promoter region. Letters indicate thecleavage sites for different restriction enzymes. Known DNA sequences are indicated by shortthick lines.22. Explain how you would isolate and then insert the coding region (Figure A) under thecontrol of the indicated promoter in the cloning vector (Figure B) to produce largeamounts of the protein in bacterial cells. Assume that the cloning vector carries the genefor tetracycline (an antibiotic) resistance.23. After trying to isolate and then insert the coding region (Figure A) under the control ofthe indicated promoter in the cloning vector (Figure B), you found that all thetransformed bacterial cells contained either one of two smaller portions of the codingregion for the gene, and some of the fragments were inserted backward (with regard toreading frame) into the cloning vector. How would you explain these observations?24. What is the purpose ofTaqpolymerase in a PCR reaction?A)DNA denaturationB)primer annealingC)DNA synthesisD)heating of the reactionE)heating of the reaction and DNA denaturation
Page 28 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 28 preview imagePage 825. Which of the following is NOT a bacterial cloning vector?A)plasmidB)bacteriophageC)agrobacteriumD)bacterial artificial chromosomeE)cosmid26. Which of the following is NOT a potential benefit of using transgenic plants?A)They can reduce the use of harmful chemical pesticides in the United States andthus provide an ecological benefit.B)They can generate restriction enzyme sites on a foreign gene of interest to becloned.C)They often increase yields, providing more food per acre and reducing the amountof land needed for agricultural use.D)They can allow crops to be grown on land previously unavailable for productiveagricultural use.E)They can be used to express large quantities of specific biological products morecheaply and quickly than by expression in animal systems.27. The difference between PCR and real-time PCR is that real-time PCR:A)can measure the amount of DNA amplified as the reaction proceeds, while standardPCR cannot.B)can amplify DNA a billion-fold within just a few hours, while standard PCRcannot.C)can determine the DNA sequence, while standard PCR cannot.D)uses DNA polymerase, while standard PCR does not.E)requires primers, while standard PCR does not.28. Which of the following represents an appropriate cloning vector for cloning a gene intoa bacterial cell?A)YACB)Ti plasmidC)plasmidD)Agrobacterium tumefaciensE)lacZ
Page 29 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 29 preview imagePage 929. Ampicillin resistance is toampRas _____ is tolacZ.A)Bt toxinB)G418C)cleavage of X-galD)penicillin resistanceE)gancyclovir30. Which of the following can be used for genetic engineering in plants?A)Ti plasmidB)Agrobacterium tumefaciensC)selectable markersD)Ti plasmids andAgrobacterium tumefaciensonlyE)Ti plasmids,Agrobacterium tumefaciens, and selectable markers31. Which of the following statements is NOT true regarding the basic components requiredfor a bacterial cloning vector?A)Selectable markers provide a means for preferentially allowing growth of onlythose bacterial cells that have been transformed with the cloning vector.B)Unique restriction enzyme sites allow for larger pieces of foreign DNA to beinserted into the bacterial cloning vector.C)Unique restriction enzyme sites provide a means for inserting the foreign DNA intothe cloning vector at a specific known sequence site.D)A bacterial origin of replication ensures that the plasmid is replicated while presentwithin the bacterial cell.E)Selectable markers provide a means for selecting cells that have been transformedwith a recombinant plasmid.32. You have discovered a gene that enables organisms to accumulate gold in their tissuesby concentrating trace amounts found in normal soil. You want to transfer this gene intoa plant.Order the steps below that would accomplish this goal.1.Infect the plant with theAgrobacteriumstrain.2.Digest the gold gene and a Ti plasmid with appropriate restriction enzymes.3.Insert the gold gene into the Ti plasmid.4.Amplify the gold gene with PCR.5.Transfer the recombinant Ti plasmid intoAgrobacterium tumefaciens.6.Use a selectable marker to identify plant cells that have integrated therecombinant plasmid into their genome.A)4, 2, 3, 5, 1, 6B)4, 5, 2, 3, 1, 6C)4, 2, 5, 1, 6, 3D)4, 3, 2, 5, 1, 6
Page 30 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 30 preview imagePage 1033. Consider a tobacco plant cell that was able to express a toxin that was lethal to insectsand was resistant to the antibiotic kanamycin. Which of the following genes would thiscell contain?A)BtB)neo+C)lacZD)Btandneo+onlyE)Bt,neo+, andlacZUse the following to answer questions 34-36:A student carries out PCR using the following steps:Step 1: 94°C for 1 minuteStep 2: 60°C for 30 secondsStep 3: 72°C for 30 seconds34. Which of the following lists the CORRECT terms for these three steps?A)denaturation of the double-stranded template, extension of the new DNAmolecules, primer annealingB)denaturation of the double-stranded template, primer annealing, extension of thenew DNA moleculesC)denaturation of the double-stranded template, extension of the new DNAmolecules, hybridization of the templateD)degradation of the template, primer annealing, extension of the new DNAmoleculesE)hybridization of the single-stranded templates, primer annealing, extension of thenew DNA molecules35. After subjecting his PCR reaction to gel electrophoresis, the student sees no PCRproduct on the gel.What error(s) might he have made? (Select all that apply.)A)He carried out step 1 at too low a temperature.B)He carried out step 1 at too high a temperature.C)He carried out step 2 at too low a temperature.D)He carried out step 2 at too high a temperature.E)He carried out step 3 for too short a time.
Page 31 of 31
Test Bank For Genetics: A Conceptual Approach, 6th Edition - Page 31 preview imagePage 1136. After electrophoresing his PCR reaction, the student sees the desired PCR product onthe gel as well as several smaller bands. What error(s) might he have made? (Select allthat apply.)A)He carried out step 2 at too low a temperatureB)He carried out step 2 at too high a temperature.C)He designed primers with repetitive sequences.D)He contaminated the template DNA sample.E)He carried out step 3 for too short a time.Use the following to answer questions 37-38:A scientist carries out a ligation reaction designed to insert a foreign piece of DNA into aplasmid that contains the front end of thelacZgene within the multiple cloning site (MCS). Hecarries out three transformations in parallel withlacZbacteria. The three transformations (i, ii,and iii) contain the following:i.sterile waterii.a sample of the original plasmidiii.the ligation reactionHe then plates the transformations on medium containing X-gal and ampicillin.37. What results would indicate the scientist should proceed to culture colonies from (iii)that might contain the desired clone?A)Many blue colonies on all three plates.B)White colonies on plates (i) and (ii) and predominantly blue colonies on plate (iii).C)No colonies on plate (i), white colonies on plate (ii), and predominantly bluecolonies on plate (iii).D)No colonies on plate (i), blue colonies on plate (ii), and predominantly whitecolonies on plate (iii).E)No colonies on plate (i), blue colonies on plate (ii), and predominantly bluecolonies on plate (iii).38. The scientist observed colonies on plate (i). Which of the following might be reasons(s)for this? (Select all that apply.)A)The plasmid he used has a kanamycin resistance marker instead of an ampicillinresistance marker.B)He transformed cells that were not actually ampicillin sensitive.C)Too high a concentration of ampicillin was added to the plates.D)Too low a concentration of ampicillin was added to the plates.E)The water sample was contaminated with the original plasmid.
Preview Mode

This document has 561 pages. Sign in to access the full document!