Back to AI Flashcard MakerBiology /Chapter 1: DNA Study Questions

Chapter 1: DNA Study Questions

Biology20 CardsCreated 9 months ago

This deck covers key concepts related to DNA structure, function, and replication, as well as methods of genetic transfer and enzyme functions.

What is the function of DNA in the cell?

DNA is a storage system. The function of DNA is to store genetic information.

Rate to track your progress ✦

Tap or swipe ↕ to flip
Swipe ←→Navigate
1/20

Key Terms

Term
Definition
What is the function of DNA in the cell?
DNA is a storage system. The function of DNA is to store genetic information.
Compare the structure of the nitrogen bases. How do purines and pyrimidines differ?
Purines have a double ring; pyrimidines have a single ring.
Write the complementary sequence to the following: 5' AGGTCACGTCTAGCTAGCTAGA 3'
5' TCTAGCTAGCTAGACGTGACCT 3'
Which of the ribose carbons participate in the phosphodiester bond?
The 5' ribose carbon carries the phosphate group that forms a phosphodiester bond with the hydroxyl group on the 3' ribose carbon.
Which of the ribose carbons carries the nitrogen base?
The 1' carbon of the ribose carries the nitrogen base.
Why does DNA polymerase require primase activity?
DNA polymerase cannot begin synthesis without a 3' OH group.

Related Flashcard Decks

TermDefinition
What is the function of DNA in the cell?
DNA is a storage system. The function of DNA is to store genetic information.
Compare the structure of the nitrogen bases. How do purines and pyrimidines differ?
Purines have a double ring; pyrimidines have a single ring.
Write the complementary sequence to the following: 5' AGGTCACGTCTAGCTAGCTAGA 3'
5' TCTAGCTAGCTAGACGTGACCT 3'
Which of the ribose carbons participate in the phosphodiester bond?
The 5' ribose carbon carries the phosphate group that forms a phosphodiester bond with the hydroxyl group on the 3' ribose carbon.
Which of the ribose carbons carries the nitrogen base?
The 1' carbon of the ribose carries the nitrogen base.
Why does DNA polymerase require primase activity?
DNA polymerase cannot begin synthesis without a 3' OH group.
What is the covalent bond between nucleotides catalyzed by DNA polymerase?
The covalent bond between nucleotides is a phosphodiester bond.
Is DNA replication conservative or semi-conservative?
DNA replication is semi-conservative.
What is the lagging strand in DNA synthesis?
During DNA replication, the lagging strand is the strand positioned 5' to 3' with respect to the direction of synthesis, requiring the replication assembly to jump ahead and read back 3' to 5' toward the moving replication fork. The leading strand is read continuously 3' to 5'. Synthesis thus proceeds 5' to 3' on both strands.
Short pieces of DNA involved in DNA synthesis in replicating cells are called _______ fragments.
Okazaki
What is the function of polymerase?
Catalyzes formation of a phosphodiester bond between nucleotides.
What is the function of helicase?
Unwinds nucleic acids, relieving stress on the double helix by breaking and re-attaching phosphodiester bonds.
What is the function of primase?
An RNA polymerase that starts replication in the absence of a 3' OH group.
What is the function of exonuclease?
Digests phosphodiester bonds from the ends of nucleic acid molecules.
What is the function of endonuclease?
Breaks the phosphodiester bonds in nucleic acids within the polymer chains, rather than from the ends.
Compare how DNA moves from cell to cell by (a) conjugation, (b) transduction, and (c) transformation.
For conjugation, DNA moves from cell to cell through physical contact. For transduction, DNA moves from cell to cell through intermediary viruses or bacteriophages. For transformation, DNA moves from cell to cell without physical contact or viral carriers.
Bacteria with phenotype A+ are mixed with bacteria with phenotype A- in a culture. Some of the A- bacteria become A+. When A+ bacteria are removed from the culture and A- bacteria are grown in the A+ cell culture medium only, they all remain A-. What type of transfer occurred in the mixed culture?
Conjugation occurred in the mixed culture. If the A- bacteria became A+ through transformation or transduction, the cell culture medium from the A+ bacteria would contain DNA or phage, respectively, capable of transforming A- bacteria to A+.
What was the rationale for labeling bacteriophage with 35S and 32P in the Hershey and Chase 'blender' experiment?
35S labels protein, specifically since there is no S in nucleic acid specifically, since there was no P in the phage proteins.
A plasmid that carries genes for its own transfer and propagation is called _________.
A plasmid that carries genes for its own transfer and propagation is called self-transmissible.
What enzymes can convert a supercoiled plasmid to a relaxed circle?
Helicases (topoisomerases) can digest the phosphodiester bond in one strand of the double-stranded DNA, allowing the twisted strands to unwind.