Skip to content
Past Exams

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions)

Identify common exam themes with 2023-2024 MB ASCP Mathematics Connect Exam With Answers, packed with past test papers.

Preview 8 of 25 pages

See the first 8 pages exactly as they appear in the document.

  1. Page 1
    Read page 1 as text

    MB ASCP CONN ECT EXAM - with 100% verified solutions - 2023 - 2024 What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC - A1 3 2/3 2.18 LOC - B2 7/5 5 0.798 LOC - C3 17/17 9/17 5.21 LOC - D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% 92.5 % Multiply all PI together = CPI (CPI x PP) / [CPI x P + (1 - PP) OR ... CPI / (1 + CPI) You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg

  2. Page 2
  3. Page 3
    Read page 3 as text

    Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: a. Frame - shift mutation b. Inserti on c. Silent mutation d. Non - conservative mutation Frame - shift mutation Which of the following is not involved in the splicing reaction? a. 5' splice site b. Hairpin loops c. Branch A point d. 3' splice site Hairpin loops Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer) a. At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. b. The melting temperature of double stranded DNA depends on its base com position and length. c. All PCR products for a specific primer pair should have the same melting temperature. d. When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. At the melting point, the p robe separates from the target strand and fluorescence rapidly decreases. The melting temperature of double stranded DNA depends on its base composition and length. All PCR products for a specific primer pair should have the same melting temperature. In the field of molecular diagnostics, which one of the following genes is responsible for the synthesis of DNA, promote cell division, and inhibit cell death?

  4. Page 4
    Read page 4 as text

    a. Proto - oncogenes b. Tumor suppressor genes c. Oncogenes d. Mitochondrial genes Proto - oncogenes Microsatellite instability is best described as: a. The ability of a gene with repeating elements of 8 - 10 base pairs to randomly mutate b. Contraction or expansion of the genome caused by frameshift mutations (deleti ons or insertions) in elements of the genome consisting of a repeating sequence of 1 - 3 base pairs c. Repetitive elements in the genome with the ability to self - prime, thus creating additional copies of genetic material at the allele loci d. Random gene rea rrangement between repeating elements of the same size on different chromosomes resulting in different size gene products Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting o f a repeating sequence of 1 - 3 base pairs Purines and pyrimidines differ from each other in that: a. Purines are found RNA; pyrimidines are found in DNA b. There's no difference between purines and pyrimidines c. Pyrimidines have two rings; purines have on e ring d. Purines have two rings; pyrimidines have one ring Purines have two rings; pyrimidines have one ring TIP: Reciprocals of each other. Purine, shorter word, longer rings. Pyrimidine, longer word, shorter ring. Which of the following molecular metho dologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease? a. Heteroduplex analysis b. Variable number tandem repeat analysis c. Single strand conformation polymorphism analysis d. Reverse - Transcriptase PCR

  5. Page 5
    Read page 5 as text

    Vari able number tandem repeat analysis Locus Test C M PF1 PF2 A1 12/15 12 15/17 12/15 B2 13 13/13 13/15 14/15 C3 7/8 8 7 7/7 D4 9/11 9/9 10/11 11 E5 6 6/6 5/7 6 Based on the results above, which one of the two possible fathers is the two - month old's biologic al father? a. Possible Father 1 b. Possible Father 2 c. Neither of the Possible Fathers Neither Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta - globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phe notypic traits is best referred to as: a. Pleiotrophy b. Polygenic inheritance c. Epistasis d. Epigenetics Pleiotrophy A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract wa s re - suspended in 0.800 mL of EDTA solution, the DNA yield is: a. 3540 micrograms b. 3450 micrograms c. 3504 micrograms d. 3054 micrograms

  6. Page 6
    Read page 6 as text

    3054 ug 260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield 260 x 50 x 30 x 0.8 = 3054 When sequencing HLA - DR what is targeted? a. Exon 1 of the α subunit b. Exon 2 of the α subunit c. Exon 1 of the β subunit d. Exon 2 of the β subunit Exon 2 of the β subunit All of the following are components of nucleic acids, EXCEPT: a. Phosphate group b. Sugar (ribose or deoxyribose) c. Nitrogenous base (A, G, C, T) d. Formamide Formamide This polymerase acts on DNA and produces Transfer RNA: a. RNA Po l II b. DNA Pol II c. RNA Pol III d. DNA Pol III RNA pol III In mantle cell lymphoma (MCL), this is the fusion gene created: a. EWS - FLI1 b. CCND1 - IGH c. BCR - IGH d. c - myc - EWS CCND1 - IGH (Cyclin D1)

  7. Page 7
    Read page 7 as text

    This enzyme is known for "unzipping" genes: a. Alkaline P hosphatase b. RNA polymerase c. Apyrase d. Helicase Helicase What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? a. t(18;X) b. t(15;17) c. t(8;X) d. t(9;12) t(18;X) Which of the following reagents will successfully decontam inate a bench top that has been exposed to DNA amplification products? a. 70% Ethanol b. 5% Bleach c. 100% Isopropanol d. 10% Methanol 5% Bleach As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus , coronavirus, and influenza. Which PCR method would best be suitable for this task? a. Nested PCR b. Real - time PCR c. NASBA d. Multiplex PCR Multiplex PCR According to Chargaff's rule of base pairing, adenine pairs with: a. Cytosine b. Threonine

  8. Page 8
    Read page 8 as text

    c. Thym ine d. Thymidine Tymine The t(11;22) translocation is responsible for: a. Follicular lymphoma b. Papillary thyroid cancer c. Synovial sarcoma d. Ewing sarcoma Ewing sarcoma TIP: Affects children and adults between the ages of 11 - 22 Replication forks, k nown as origins of DNA replication, are created by this enzyme: a. Ligase b. Taq Polymerase c. Primase d. Helicase Helicase What enzyme is involved in LCR? a. Taq polymerase b. RNA polymerase c. DNA Ligase d. Luciferase DNA Ligase A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: a. 76.35 micrograms/mL b. 3817.5 micrograms/mL c. 381.75 mi crograms/mL d. 3054.0 micrograms/mL

17 more pages in the full document

Unlock it once and it stays in your library, ready to chat with or turn into flashcards.

Unlock the full document

More Mathematics study materials

See all

Study this document with CramX

Once it is in your library, every tool can work from it.