2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions)

Page 1 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 1 preview image

MB ASCP CONNECT EXAM-with 100%verified solutions-2023-2024What is translocation is associated with Burkitt's Lymphoma?a. t(18; 14)b. t(9; 22)c. t(8; 14)d. t(15; 17)t(8; 14)TIP: Burkkitt's 8 letters,Locus PF Child Paternity IndexLOC-A1 3 2/3 2.18LOC-B2 7/5 5 0.798LOC-C3 17/17 9/17 5.21LOC-D4 12 12 1.37Based on the data presented in the table above and with a prior probability (PP) of0.5, the probability of paternity in this case is :a. 92.5%b. 99.5%c. 90.5 &d. 95.5%92.5 %Multiply all PI together = CPI(CPI x PP) / [CPI x P + (1-PP)OR ...CPI / (1 + CPI)You have sequenced a gene and observe the following:Reference: atgctggcacgacaggtttcccgactgg

Page 2 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 2 preview image

Page 3 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 3 preview image

Sequenced: atgCctggcacgacaggtttcccgactggThe mutation observed is a:a. Frame-shift mutationb. Insertionc. Silent mutationd. Non-conservative mutationFrame-shift mutationWhich of the following is not involved in the splicing reaction?a. 5' splice siteb. Hairpin loopsc. Branch A pointd. 3' splice siteHairpin loopsWhich of the following statementsare characteristics of the melt curve analysis?(hint: more than one answer)a. At the melting point, the probe separates from the target strand and fluorescencerapidly decreases.b. The melting temperature of double stranded DNA depends on its basecomposition and length.c. All PCR products for a specific primer pair should have the same meltingtemperature.d. When hybridization probes are utilized, the temperature is incrementallydecreased while fluorescence is monitored.At the melting point, the probe separates from the target strand and fluorescencerapidly decreases.The melting temperature of double stranded DNA depends on its base compositionand length.All PCR products for a specific primer pair should have the same meltingtemperature.Inthe field of molecular diagnostics, which one of the following genes is responsiblefor the synthesis of DNA, promote cell division, and inhibit cell death?

Page 4 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 4 preview image

a. Proto-oncogenesb. Tumor suppressor genesc. Oncogenesd. Mitochondrial genesProto-oncogenesMicrosatellite instability is best described as:a. The ability of a gene with repeating elements of 8-10 base pairs to randomlymutateb. Contraction or expansion of the genome caused by frameshift mutations(deletions or insertions) in elements of the genome consisting of a repeatingsequence of 1-3 base pairsc. Repetitive elements in the genome with the ability to self-prime, thus creatingadditional copies of genetic material at the allele locid. Random gene rearrangement between repeating elements of the same size ondifferent chromosomes resulting in different size gene productsContraction or expansion of the genome caused by frameshift mutations (deletionsor insertions) in elements of the genome consisting of a repeating sequence of 1-3base pairsPurines and pyrimidines differ from each other in that:a. Purines are found RNA; pyrimidines are found in DNAb. There's no difference between purines and pyrimidinesc. Pyrimidines have two rings; purines have one ringd. Purines have two rings; pyrimidines have one ringPurines have two rings; pyrimidines have one ringTIP: Reciprocals of each other.Purine, shorter word, longer rings.Pyrimidine, longer word, shorter ring.Which of the following molecular methodologies would be the best for detecting atrinucleotide repeat disorder such as Huntington's disease?a. Heteroduplex analysisb. Variable number tandem repeat analysisc. Single strand conformation polymorphism analysisd. Reverse-Transcriptase PCR

Page 5 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 5 preview image

Variable number tandem repeat analysisLocus Test C M PF1 PF2A1 12/15 12 15/17 12/15B2 13 13/13 13/15 14/15C3 7/8 8 7 7/7D4 9/11 9/9 10/11 11E5 6 6/6 5/7 6Based on the results above, which one of the two possible fathers is the two-monthold's biological father?a. Possible Father 1b. Possible Father 2c. Neither of the Possible FathersNeitherSickle cell disease is an autosomal genetic disease due to a point mutation in thebeta-globin gene, where glutamic acid is substituted for valine at the sixthcodon ofthe gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of manygenetic diseases where a single gene controls the expression of many phenotypictraits. The phenomenon where a single gene controls the expression of manyphenotypic traits is best referred to as:a. Pleiotrophyb. Polygenic inheritancec. Epistasisd. EpigeneticsPleiotrophyA technologist uses the spectrophotometer to quantify the amount of DNA extractedfrom a blood specimen diluted 1:30. The absorbance reading at 260 nm was found tobe 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNAextract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is:a. 3540 microgramsb. 3450 microgramsc. 3504 microgramsd. 3054 micrograms

Page 6 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 6 preview image

3054 ug260 reading x 50 ug/ml (DNA) x dilution factor x resupsension = DNA Yield260 x 50 x 30 x 0.8 = 3054When sequencing HLA-DR what is targeted?a. Exon 1 of the α subunitb. Exon 2 of the α subunitc. Exon 1 of the β subunitd. Exon 2 of the β subunitExon2 of the β subunitAll of the following are components of nucleic acids, EXCEPT:a. Phosphate groupb. Sugar (ribose or deoxyribose)c. Nitrogenous base (A, G, C, T)d. FormamideFormamideThis polymerase acts on DNA and produces Transfer RNA:a. RNA Pol IIb. DNA Pol IIc. RNA Pol IIId. DNA Pol IIIRNA pol IIIIn mantle cell lymphoma (MCL), this is the fusion gene created:a. EWS-FLI1b. CCND1-IGHc. BCR-IGHd. c-myc-EWSCCND1-IGH(Cyclin D1)

Page 7 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 7 preview image

This enzyme is known for "unzipping" genes:a. Alkaline Phosphataseb. RNA polymerasec. Apyrased. HelicaseHelicaseWhat translocation results in synovial sarcoma, a muscle and fibrous tissue cancer?a. t(18;X)b. t(15;17)c. t(8;X)d. t(9;12)t(18;X)Which of the following reagents will successfully decontaminate a bench top that hasbeen exposed to DNA amplification products?a. 70% Ethanolb. 5% Bleachc. 100% Isopropanold. 10% Methanol5% BleachAs a technologist working in a small clinical laboratory, a nasal swab specimen,suspected to be colonized by a variety of upper respiratory viruses, came to yourlaboratory. You are tasked with determining whether the specimen is colonized withrhinovirus, coronavirus, and influenza. Which PCR method would best be suitable forthis task?a. Nested PCRb. Real-time PCRc. NASBAd. Multiplex PCRMultiplex PCRAccording to Chargaff's rule of base pairing, adenine pairs with:a. Cytosineb. Threonine

Page 8 of 8

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 8 preview image

c. Thymined. ThymidineTymineThe t(11;22) translocation is responsible for:a. Follicular lymphomab. Papillary thyroid cancerc. Synovial sarcomad. Ewing sarcomaEwing sarcomaTIP: Affects children and adults between the ages of 11-22Replication forks, known as origins of DNA replication, are created by this enzyme:a. Ligaseb. Taq Polymerasec. Primased. HelicaseHelicaseWhat enzyme is involved in LCR?a. Taq polymeraseb. RNA polymerasec. DNA Ligased. LuciferaseDNA LigaseA technologist uses thespectrophotometer to quantify the amount of DNA extractedfrom a blood specimen diluted 1:30. The absorbance reading at 260 nm was found tobe 2.545. The concentration of DNA in this extract is:a. 76.35 micrograms/mLb. 3817.5 micrograms/mLc. 381.75 micrograms/mLd. 3054.0 micrograms/mL

Preview Mode

This document has 25 pages. Sign in to access the full document!

Report

Learning Tools

Writing Tools

Browse Resources

2023-2024 MB ASCP Mathematics Connect Exam With Answers (97 Solved Questions) - Page 1

Study Now!

Document Details

Related Documents

Precalculus - Polynomial and Rational Functions

Precalculus - Functions

Precalculus - Exponential and Logarithmic Functions

Math Word Problems - Translating Expressions

Math Word Problems - Equations

Algebra II – Word Problems

Algebra II – Sequences and Series

Algebra II - Segments Lines and Inequalities

Algebra II - Relations and Functions

Algebra II - Rational Expressions

Company

Explore

Study Tools